PCR
(Polymerase
Chain Reaction)
Background
Now
that you have learnt that DNA is the genetic material
of life, let's examine some technologies prevalent
in the field of genetics.
One
of these techniques is Polymerase Chain Reaction or
PCR. PCR is an ingenious technique that allows scientists
to amplify a specific DNA sequence millions of times
in just hours. With this technique, a very small sample
of DNA can be sufficiently multiplied so that enough
of it can be used for testing like in DNA fingerprinting.
The technique which was invented by Nobel prize winner
Dr Kary Mullis in 1983 has revolutionized many areas
of genetic research. PCR can be used to identify with
a very high-probability, disease-causing viruses and/or
bacteria, a deceased person, or a criminal suspect.
[In
order to use PCR, one must already know the exact
sequences which flank (lie on either side of) both
ends of a given region of interest in DNA (may be
a gene or any sequence). One need not know the DNA
sequence in-between. The building-block sequences
(nucleotide sequences) of many of the genes and flanking
regions of genes of many different organisms are known.
We also know that the DNA of different organisms is
different (while some genes may be the same, or very
similar among organisms, there will always be genes
whose DNA sequences differ among different organisms
- otherwise, would be the same organism (e.g., same
virus, same bacterium, an identical twin; therefore,
by identifying the genes which are different, and
therefore unique, one can use this information to
identify an organism).
Recall
that a gene's building-block sequence is the precise
order of appearance, one after the other, of 4 different
components (deoxyribonucleotides) within a stretch
of DNA (deoxyribonucleic acid). The 4 components are:
Adenine, Thymidine, Cytosine and Guanine, abbreviated
as: A, T, C and G, respectively (a 4-letter alphabet).
The arrangement of the letters (one after the other)
of this 4-letter alphabet generates a "sentence"
(a gene sequence). The number of letters in the sentence
may be relatively few, or relatively many, depending
on the gene. If the sentence is 1000 letters-long,
the sequence would be said to be 1 kilobase (1000
bases).
As
an example:
ATATCGGGTTAACCCCGGTATGTACGCTA would represent part
of one gene. DNA is double-stranded (except in some
viruses), and the two strands pair with one another
in a very precise way. EACH letter in a strand will
pair with only one kind of letter across from it in
the opposing strand: A ALWAYS pairs with T; and, C
ALWAYS pairs with G across the two strands.
So:
TTAACGGGGCCCTTTAAA........TTTAAACCCGGGTTT
Would
pair with:
AATTGCCCCGGGAAATTT........AAATTTGGGCCCAAA
Now, let's say that the above sequences "flank"
(are on either end of..) the gene, which includes
a long stretch of letters designated as: ..............
These are known, absolutely identified to be, the
sequence of letters which ONLY flank a particular
region of a particular organism's DNA, and NO OTHER
ORGANISM'S DNA. This region would be a target sequence
for PCR.
The
first step for PCR would be to synthesize "primers"
of about 20 letters-long, using each of the 4 letters,
and a machine which can link the letters together
in the order desired - this step is easily done, by
adding one letter-at-a-time to the machine (DNA synthesizer).
In this example, the primers we wish to make will
be exactly the same as the flanking sequences shown
above. We make ONE primer exactly like the lower left-hand
sequence, and ONE primer exactly like the upper right-hand
sequence, to generate:
TTAACGGGGCCCTTTAAA........TTTAAACCCGGGTTT
AATTGCCCCGGGAAATTT.......................>
and:
<.....................................................TTTAAACCCGGGTTT
AATTGCCCCGGGAAATTT........AAATTTGGGCCCAAA
If
you look at this arrangement, you can see that if
the lower left-hand primer sequence (italics) paired
to the upper strand could be extended to the right
in the direction of the arrow, and the upper right-hand
sequence paired to the lower strand could be extended
to the left in the direction of the arrow (remembering
that the ......... also represent letters, and opposite
pairing will ALWAYS be A to T and C to G), one could
successfully exactly duplicate the original gene's
entire sequence. Now there would be four strands,
where originally there were only two. If one leaves
everything in there, and repeats the procedure, now
there will be eight strands, do again - now 16, etc..
therefore, about 20 cycles will theoretically produce
approximately one-million copies of the original sequences
(2 raised to the 20th power).
Thus,
with this amplification potential, there is enough
DNA in one-tenth of one-millionth of a liter (0.1
microliter) of human saliva (contains a small number
of shed epithelial cells), to use the PCR system to
identify a genetic sequence as having come from a
human being! Consequently, only a very tiny amount
of an organism's DNA need be available originally.
Enough DNA is present in an insect trapped within
80 million year-old amber (fossilized pine resin)
to amplify by this technique! Scientists have used
primers which represent present-day insect's DNA,
to do these amplifications.]
PCR
Steps
Here
is how PCR is performed:
First
step: unknown DNA is heated, which causes the paired
strands to separate (single strands now accessible
to primers).
Picture
reproduced with permission from
http://allserv.rug.ac.be/~avierstr/principles/pcr.html
Second
step: add large excess of primers relative to the
amount of DNA being amplified, and cool the reaction
mixture to allow double-strands to form again (because
of the large excess of primers, the two strands will
always bind to the primers, instead of with each other).
Picture
reproduced with permission from
http://allserv.rug.ac.be/~avierstr/principles/pcr.html
Third
step: to a mixture of all 4 individual letters (deoxyribonucleotides),
add an enzyme which can "read" the opposing
strand's "sentence" and extend the primer's
"sentence" by "hooking" letters
together in the order in which they pair across from
one another - A:T and C:G. This particular enzyme
is called a DNA polymerase (because makes DNA polymers).
One such enzyme used in PCR is called Taq polymerase
(originally isolated from a bacterium that can live
in hot springs - therefore, can withstand the high
temperature necessary for DNA-strand separation, and
can be left in the reaction). Now, we have the enzyme
synthesizing new DNA in opposite directions - BUT
ONLY THIS PARTICULAR REGION OF DNA.
Picture
reproduced with permission from
http://allserv.rug.ac.be/~avierstr/principles/pcr.html
After
one cycle, add more primers, add 4-letter mixture,
and repeat the cycle. The primers will bind to the
"old" sequences as well as to the newly-synthesized
sequences. The enzyme will again extend primer sentences
... Finally, there will be PLENTY of DNA - and ALL
OF IT will be copies of just this particular region.
Therefore, by using different primers which represent
flanking regions of different genes of various organisms
in SEPARATE experiments, one can determine if in fact,
any DNA has been amplified. If it has not, then the
primers did not bind to the DNA of the sample, and
it is therefore highly unlikely that the DNA of an
organism which a given set of primers represents,
is present. On the other hand, appearance of DNA by
PCR will allow precise identification of the source
of the amplified material.
Click
here to see a simplified interactive illustrated sequence
of PCR
Section
of material between the square brackets [ ] reproduced
with permission from John (Jack) C. Brown, Professor,
Department of Molecular Biosciences, University of
Kansas, Lawrence, Kansas.
